After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TPP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TPP1cDNA Clone Product Information
cDNA Size:1692
cDNA Description:ORF Clone of Homo sapiens tripeptidyl peptidase I DNA.
Gene Synonym:CLN2, GIG1, LPIC, TPP-1, TPP1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Tripeptidyl-peptidase 1 (TPP1 / CLN2) is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. TPP1 / CLN2 May act as a non-specific lysosomal peptidase which generates tripeptides from the breakdown products produced by lysosomal proteinases. Defects in TPP1 / CLN2 are the cause of neuronal ceroid lipofuscinosis type 2 (CLN2), a form of neuronal ceroid lipofuscinosis which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome. Neuronal ceroid lipofuscinoses are progressive neurodegenerative, lysosomal storage diseases characterized by intracellular accumulation of autofluorescent liposomal material, and clinically by seizures, dementia, visual loss, and/or cerebral atrophy.

  • Xin H, et al. (2007) TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature. 445(7127): 559-62.
  • O'Connor MS, et al. (2006) A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proc Natl Acad Sci U S A. 103(32): 11874-9.
  • Abreu E, et al. (2010) TIN2-tethered TPP1 recruits human telomerase to telomeres in vivo. Mol Cell Biol. 30(12): 2971-82.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items