After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse ADIPOQ Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ADIPOQcDNA Clone Product Information
cDNA Size:780
cDNA Description:ORF Clone of Mus musculus adiponectin, C1Q and collagen domain containing DNA.
Gene Synonym:APN, Acdc, apM1, 30kDa, GBP28, adipo, Acrp30, Adipoq
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Adiponectin (ADIPOQ), or 30 kDa adipocyte complement-related protein (Acrp30) is a protein secreted by adipose tissue, which acts to reduce insulin resistance and atherogenic damage, but it also exerts actions in other tissues. Adiponectin mediates its actions in the periphery mainly via two receptors, AdipoR1 and AdipoR2. Adiponectin influences gonadotropin release, normal pregnancy, and assisted reproduction outcomes. Adiponectin, a beneficial adipokine, represents a major link between obesity and reproduction. Higher levels of adiponectin are associated with improved menstrual function and better outcomes in assisted reproductive cycles. Unlike other adipocytokines produced by adipose tissue, adiponectin appears to have anti-inflammatory, anti-diabetic, and anti-atherogenic properties. Several clinical studies demonstrate the inverse relationship between plasma adiponectin levels and several inflammatory markers including C-reactive protein. Adiponectin attenuates inflammatory responses to multiple stimuli by modulating signaling pathways in a variety of cell types. The anti-inflammatory properties of adiponectin may be a major component of its beneficial effects on cardiovascular and metabolic disorders including atherosclerosis and insulin resistance. Additionally, it is important factor in chronic liver diseases and chronic kidney diseases. Some cancer cell types express adiponectin receptors. Thus Adiponectin may act on tumour cells directly by binding and activating adiponectin receptors and downstream signalling pathways.

  • Cui J, et al. (2011) The role of adiponectin in metabolic and vascular disease: a review. Clin Nephrol. 75(1): 26-33.
  • Michalakis KG, et al. (2010) The role of adiponectin in reproduction: from polycystic ovary syndrome to assisted reproduction. Fertil Steril. 94(6): 1949-57.
  • Dez JJ, et al.. (2010) The role of the novel adipocyte-derived protein adiponectin in human disease: an update. Mini Rev Med Chem. 10(9): 856-69.
  • Ouchi N, et al. (2007) Adiponectin as an anti-inflammatory factor. Clin Chim Acta. 380(1-2): 24-30.
  • Barb D, et al. (2006) Adiponectin: a link between obesity and cancer. Expert Opin Investig Drugs. 15(8): 917-31.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Mouse ADIPOQ Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged
    Recently Viewed Items