Quick Order

Text Size:AAA

Human MYC ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MYC cDNA Clone Product Information
Gene_bank_ref_id:NM_002467.3
RefSeq ORF Size:1365bp
cDNA Description:Full length Clone DNA of Homo sapiens v-myc myelocytomatosis viral oncogene homolog (avian) with N terminal HA tag.
Gene Synonym:c-Myc, bHLHe39, MYC
Species:Human
Vector:pCMV3-N-HA
Plasmid:pCMV3-HA-MYC
Restriction Site:KpnI + XbaI (6kb + 1.42kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein. It can help to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. Myc Tag also can be used to isolate protein complexes with multiple subunits. The Myc Tag Antibody is produced by the conjugation of a synthetic Myc tag peptide to KLH. Myc Tag Antibody can be used in various immunoassays, such as ELISA, Western blotting, immunoprecipitation, immunofluorescence, and more.

References
  • Ding X, et al., 2009, PLoS One. 4(6): e5949.
  • Ratsima H, et al., 2011, Proc Natl Acad Sci. 108(43): E914-23.
  • Chiang YJ, et al., 2013, PLoS One. 8(4): e61761.
  • Size / Price
    Catalog: HG11346-NY
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"