Quick Order

Rat CDH15 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CDH15 cDNA Clone Product Information
Gene_bank_ref_id:NM_207613.1
RefSeq ORF Size:2355bp
cDNA Description:Full length Clone DNA of Rattus norvegicus cadherin 15 with C terminal Myc tag.
Gene Synonym:Cdh15
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cadherin-15, also known as CDH15, is a member of the cadherin superfamily. Cadherins consist of an extracellular domain containing 5 cadherin domains, a transmembrane region, and a conserved cytoplasmic domain. Cadherins are calcium dependent cell adhesion proteins. They preferentially interact with themselves in a homophilic manner in connecting cells; cadherins may thus contribute to the sorting of heterogeneous cell types. Cadherin-15 contains 5 cadherin domains. It is expressed in some normal epithelial tissues and in some carcinoma cell lines. Defects in CDH3 are the cause of ectodermal dysplasia with ectrodactyly and macular dystrophy (EEM), also known as EEM syndrome, Albrectsen-Svendsen syndrome or Ohdo-Hirayama-Terawaki syndrome. Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EEM is an autosomal recessive condition characterized by features of ectodermal dysplasia such as sparse eyebrows and scalp hair, and selective tooth agenesis associated with macular dystrophy and ectrodactyly.

References
  • Shibata T, et al. (1997) Identification of human cadherin-14, a novel neurally specific type II cadherin, by protein interaction cloning. J Biol Chem. 272(8):5236-40.
  • Bornemann A, et al. (1994) Immunocytochemistry of M-cadherin in mature and regenerating rat muscle. Anat Rec. 239(2):119-25.
  • Donalies M, et al. (1991) Expression of M-cadherin, a member of the cadherin multigene family, correlates with differentiation of skeletal muscle cells. Proc Natl Acad Sci. 88(18):8024-8.
  • Size / Price
    Catalog: RG80281-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"