Quick Order

Text Size:AAA

Human FAM3B Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FAM3BcDNA Clone Product Information
cDNA Size:708
cDNA Description:ORF Clone of Homo sapiens family with sequence similarity 3, member B DNA.
Gene Synonym:2-21, ORF9, PANDER, PRED44, C21orf11, C21orf76, FAM3B
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Pancreatic derived factor, also known as FAM3B, is an islet-specific secreted cytokine specifically expressed at high levels in the islets of Langerhans of the endocrine pancreas. FAM3B protein is present in alpha- and beta- cells of pancreatic islets, insulin-secreting beta-TC3 cells, and glucagon-secreting alpha-TC cells. FAM3B causes apoptosis of beta-cells as assessed by electron microscopy, annexin Ⅴ fluorescent staining, and flow-cytometric terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling assay. FAM3B activated caspase-3 while not affect cytosolic Ca2+ levels or nitric oxide levels. Hense, FAM3B may have a role in the process of pancreatic?-cell apoptosis of primary islet and cell lines. FAM3B secretion is regulated by glucose and other insulin secretagogues. This islet-specific secreted cytokine is secreted from both pancreatic alpha- and beta- cells. Glucose stimulates FAM3B secretion dose dependently in beta- cell lines and primary islets but not in alpha-cells. It is likely cosecreted with insulin via the same regulatory mechanisms and structure and conformation is vital for FAM3B secretion.

  • Cao X, et al. (2003) Pancreatic-derived factor (FAM3B), a novel islet cytokine, induces apoptosis of insulin-secreting beta-cells. Diabetes. 52(9): 2296-303.
  • Yang J, et al. (2005) Mechanisms of glucose-induced secretion of pancreatic-derived factor (PANDER or FAM3B) in pancreatic beta-cells. Diabetes. 54(11): 3217-28.
  • Xu W, et al. (2005) Interferon-gamma-induced regulation of the pancreatic derived cytokine FAM3B in islets and insulin-secreting betaTC3 cells. Mol Cell Endocrinol. 240(1-2): 74-81.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items