Quick Order

Mouse YWHAS / SFN Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SFNcDNA Clone Product Information
cDNA Size:747
cDNA Description:ORF Clone of Mus musculus stratifin DNA.
Gene Synonym:Er, Mme1, Ywhas, Sfn
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Mouse YWHAS / SFN Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Related Products
Product nameProduct name

14-3-3 protein sigma (YWHAS), also known as stratifin (SFN) and epithelial cell marker protein 1, is a member of the14-3-3 proteins which are a family of conserved regulatory molecules expressed in all eukaryotic cells. The name 14-3-3 refers to the particular elution and migration pattern of these proteins on DEAE-cellulose chromatography and starch-gel electrophoresis. The 14-3-3 proteins eluted in the 14th fraction of bovine brain homogenate and were found on positions 3.3 of subsequent electrophoresis. There are seven genes that encode 14-3-3s in most mammals. 14-3-3 proteins have been identified as adapter proteins implicated in the regulation of a large spectrum of both general and specialized signaling pathway. More than 100 signaling proteins have been reported as 14-3-3 ligands including kinases, phosphatases, and transmembrane receptors, and the binding generally results in the modulation of the activity of the binding partner. YWHAE exists as a homodimer and present mainly in tissues enriched in stratified squamous keratinising epithelium. YWHAS has been repoted to interact with KRT17 and GAB2, and may regulate protein synthesis and epithelial cell growth by stimulating Akt/mTOR pathway upon binding to KRT17. Additionally, YWHAS (SFN) may also act as a p53-regulated inhibitor of G2/M progression.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items