Quick Order

Human ST6GALNAC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ST6GALNAC2cDNA Clone Product Information
cDNA Size:1125
cDNA Description:ORF Clone of Homo sapiens ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
  • Li GS, et al. (2007) Variants of the ST6GALNAC2 promoter influence transcriptional activity and contribute to genetic susceptibility to IgA nephropathy. Hum Mutat. 28(10): 950-7.
  • Ding JX, et al. (2009) Activity of alpha2,6-sialyltransferase and its gene expression in peripheral B lymphocytes in patients with IgA nephropathy. Scand J Immunol. 69(2): 174-80.
  • Kiryluk K, et al. (2010) Genetic studies of IgA nephropathy: past, present, and future. Pediatr Nephrol. 25(11): 2257-68.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items