Quick Order

Rat CLEC5A ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CLEC5A cDNA Clone Product Information
Gene_bank_ref_id:NM_001109377.1
RefSeq ORF Size:573bp
cDNA Description:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 5, member A with C terminal Myc tag.
Gene Synonym:Clec5a
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CLEC5A, also known as MDL1 and MDL-1, is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. CLEC5A with dnax-activation protein 12 and may play a role in cell activation. It also functions as a positive regulator of osteoclastogenesis. CLEC5A acts as a key regulator of synovial injury and bone erosion during autoimmune joint inflammation .The binding of dengue virus to CLEC5A triggers signaling through the phosphylation of TYROBP, this interaction does not result in viral entry, but stimulates proinflammatory cytokine release.

References
  • Chen ST. et al., 2008, Nature. 453 (7195): 672-6.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hillier LW. et al., 2003, Nature. 424 (6945): 157-64.
  • Size / Price
    Catalog: RG80259-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"