Quick Order

Text Size:AAA

Mouse ENPP-7 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ENPP7 cDNA Clone Product Information
NCBI RefSeq:NM_001030291.1
RefSeq ORF Size:1341bp
cDNA Description:Full length Clone DNA of Mus musculus ectonucleotide pyrophosphatase/phosphodiesterase 7 with C terminal Flag tag.
Gene Synonym:Gm254, Alk-SMase, Enpp7
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Mouse Ectonucleotide pyrophosphatase / phosphodiesterase family member 7, also known as Alkaline sphingomyelin phosphodiesterase, Intestinal alkaline sphingomyelinase, Alk-Smase, ENPP7 and NPP-7, is a single-pass type I membrane protein which belongs to the nucleotide pyrophosphatase / phosphodiesterase family. ENPP7 / NPP-7 is expressed in the intestines and human bile. ENPP7 / NPP-7 is localized at the surface of the microvillar membrane in small intestine enterocytes, as well as in endosome-like structures and in Golgi complex. The main function of ENPP7 / NPP-7 is to convert the dietary sphingomyelin into ceramide, the sphingolipid messengers via hydrolyzation. ENPP7 / NPP-7 is also reported to exert a phospholipase C activity toward palmitoyl lyso-phosphocholine. The activity of this enzyme is inhibited in a dose dependent manner by ATP, imidazole, orthovanadate and zinc ion. Further, It has been shown in studies that decreased levels of ENPP7 / NPP-7 may be associated with human colon cancer.

References
  • Wu J. et al., 2005, Biochem. J. 386:153-60.
  • Wu J. et al., 2004, Carcinogenesis 25:1327-33.
  • Duan R.-D. et al., 2003, J. Lipid Res. 44:1241-50.
  • Duan R.-D. et al., 2003, J. Biol. Chem. 278:38528-36.
  • Size / Price
    Catalog: MG50567-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"