After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse TREML2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TREML2cDNA Clone Product Information
Gene_bank_ref_id:NM_001033405.2
cDNA Size:990
cDNA Description:ORF Clone of Mus musculus triggering receptor expressed on myeloid cells-like 2 DNA.
Gene Synonym:Tlt2, Gm750, AW049306, Treml2
Species:Mouse
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Trem-like transcript 2 protein, also known as Triggering receptor expressed on myeloid cells-like protein 2, TREML2 and TLT2, is a single-pass type I  membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. TREML2 is detected in cultured B cells, T cell leukemia and monocyte leukemia. TREML2 is expressed constitutively on CD8 T-cells and induced on CD4 T-cells after activation. TREML2 is a cell surface receptor that may play a role in the innate and adaptive immune response. TREML2 acts as a counter-receptor for CD276 and interaction with CD276 on T-cells enhances T-cell activation. Murine B7-H3 specifically bound to Triggering receptor expressed on myeloid cells (TREM)-like transcript 2 (TLT-2, TREML2). TREML2 was expressed on CD8(+) T cells constitutively and on activated CD4(+) T cells. Stimulation with B7-H3 transfectants preferentially up-regulated the proliferation and IFN-gamma production of CD8(+) T cells. Transduction of TREML2 into T cells resulted in enhanced IL-2 and IFN-gamma production via interactions with B7-H3. There maybe a direct interaction between B7-H3 and TREML2 that preferentially enhances CD8(+) T cell activation.

References
  • Mungall A.J. et al., 2003, Nature. 425: 805-11.
  • Clark HF. et al., 2003, Genome Res. 13: 2265-70.
  • The MGC Project Team. et al., 2004, Genome Res. 14:2121-7.
  • Hashiguchi M., et al., 2008, Proc. Natl.Acad. Sci. USA.105:10495-500.
  • Leitner,J. et al., 2009, Eur J Immunol. 39 (7):1754-64.
  • Size / Price
    Catalog:MG50611-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"