Quick Order

Human MANF ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MANF cDNA Clone Product Information
Gene_bank_ref_id:NM_006010.3
RefSeq ORF Size:558bp
cDNA Description:Full length Clone DNA of Homo sapiens mesencephalic astrocyte-derived neurotrophic factor with N terminal HA tag.
Gene Synonym:ARP, ARMET, MGC142148, MGC142150, MANF
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

Mesencephalic astrocyte-derived neurotrophic factor, also known as Protein ARMET, Arginine-rich protein, MANF and ARMET, is a secreted protein which belongs to the ARMET family. ARMET selectively promotes the survival of dopaminergic neurons of the ventral mid-brain. It modulates GABAergic transmission to the dopaminergic neurons of the substantia nigra. ARMET enhances spontaneous, as well as evoked, GABAergic inhibitory postsynaptic currents in dopaminergic neurons. ARMET inhibits cell proliferation and endoplasmic reticulum (ER) stress-induced cell death. The N-terminal region of ARMET may be responsible for neurotrophic activity while the C-terminal region may play a role in the ER stress response. MANF reduces endoplasmic reticulum (ER) stress and has neurotrophic effects on dopaminergic neurons. Intracortical delivery of recombinant MANF protein protects tissue from ischemic brain injury. MANF has been described as a survival factor for dopaminergic neurons. MANF expression was widespread in the nervous system and non-neuronal tissues. In the brain, relatively high MANF levels were detected in the cerebral cortex, hippocampus and cerebellar Purkinje cells. The widespread expression of MANF together with its evolutionary conserved nature and regulation by brain insults suggest that it has important functions both under normal and pathological conditions in many tissue types.

References
  • Shridhar V., et al., 1996, Oncogene 12:1931-1939.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Petrova P., et al., 2003, J. Mol. Neurosci. 20:173-188.
  • Lindholm, P. et al., 2008, Mol Cell Neurosci. 39 (3):356-71.
  • Airavaara, M. et al., 2010, Exp Neurol. 225 (1):104-13.
  • Size / Price
    Catalog: HG11324-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"