After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat IL20Ra ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat IL20RA cDNA Clone Product Information
Gene_bank_ref_id:NM_001107521.1
RefSeq ORF Size:1632bp
cDNA Description:Full length Clone DNA of Rattus norvegicus interleukin 20 receptor, alpha with C terminal Myc tag.
Gene Synonym:Il20ra, Il20ra_predicted
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

Interleukin 20 receptor, alpha subunit (IL20RA/IL-20RA) also known as IL-20 receptor subunit alpha, Cytokine receptor class-II member 8, interleukin-20 receptor I, and interleukin-20 receptor subunit alpha, is a subunit for the interleukin-20 receptor. IL20RA/IL-20RA belongs to the type II cytokine receptor family. This cytokine is a receptor for interleukin 20 (IL20), a cytokine that may be involved in epidermal function. The receptor of IL20 is a heterodimeric receptor complex consisting of this protein and interleukin 20 receptor beta (IL20B). IL20RA forms heterodimer with IL20RB, and the complex serves as a receptor for IL19, IL20 and IL24. All three are capable of signaling through IL-20RA/IL-20RB complex. The ligand binding to receptor B creating a high-affinity binding site for the receptor A which is recruited to complete the complex. In addition, IL20RA also forms a heterodimer with the unique and specific receptor IL10RB and functions as the receptor for IL26. IL20RA is widely expressed with highest levels in skin, testis and brain. The expression of both IL20RA and IL20RB is found to be upregulated in psoriatic skin lesions on keratinocytes.

References
  • Parrish-Novak J, et al. (2002) Interleukins 19, 20, and 24 signal through two distinct receptor complexes. Differences in receptor-ligand interactions mediate unique biological functions. J Biol Chem. 277(49): 47517-23.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5): 445-51.
  • Blumberg H, et al. (2001) Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell. 104(1): 9-19.
  • Size / Price
    Catalog: RG80227-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"