Quick Order

Rat CADM3 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CADM3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001047103.1
RefSeq ORF Size:1191bp
cDNA Description:Full length Clone DNA of Rattus norvegicus cell adhesion molecule 3 with C terminal Myc tag.
Gene Synonym:Igsf4b, Necl-1, Cadm3
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cell Adhesion Molecules (CAMs) are proteins located on the cell surface involved with the binding with other cells or with the extracellular matrix (ECM) in the process called cell adhesion. These proteins are typically transmembrane receptors and are composed of three domains: an intracellular domain that interacts with the cytoskeleton, a transmembrane domain, and an extracellular domain that interacts either with other CAMs of the same kind (homophilic binding) or with other CAMs or the extracellular matrix (heterophilic binding). Cell adhesion molecule 3, also known as Immunoglobulin superfamily member 4B, CADM3, and NECL1, is a neural tissue-specific immunoglobulin-like cell-cell adhesion molecule which has Ca(2+)-independent homo- or heterophilic cell-cell adhesion activity and plays an important role in the formation of synapses, axon bundles and myelinated axons. Isoform 1 of CADM3 is expressed mainly in adult and fetal brain. Isoform 2 of CADM3 is highly expressed in adult brain and weakly expressed in placenta. In brain, Isoform 2 is highly expressed in cerebellum. CADM3 is involved in the cell-cell adhesion. It has both calcium-independent homophilic cell-cell adhesion activity and calcium-independent heterophilic cell-cell adhesion activity with IGSF4, PVRL1 and PVRL3. The interaction with EPB41L1 may regulate structure or function of cell-cell junctions. CADM3 may act as a tumor suppressor in glioma and loss of it in glioma may be caused by histone deacetylation.

References
  • Dong X, et al. (2006) Crystal structure of the V domain of human Nectin-like molecule-1/Syncam3/Tsll1/Igsf4b, a neural tissue-specific immunoglobulin-like cell-cell adhesion molecule. J Biol Chem. 281(15): 10610-7.
  • Gao J, et al. (2008) Nectin-like molecule 1 is a glycoprotein with a single N-glycosylation site at N290KS which influences its adhesion activity. Biochim Biophys Acta. 1778(6): 1429-35.
  • Gao J, et al. (2009) Loss of NECL1, a novel tumor suppressor, can be restored in glioma by HDAC inhibitor-Trichostatin A through Sp1 binding site. Glia. 57(9): 989-99.
  • Size / Price
    Catalog: RG80220-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"