After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CLU Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLUcDNA Clone Product Information
cDNA Size:1506
cDNA Description:ORF Clone of Homo sapiens clusterin DNA.
Gene Synonym:CLI, AAG4, APOJ, KUB1, SGP2, SGP-2, SP-40, TRPM2, TRPM-2, MGC24903, CLU
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Clusterin, also known as complement-associated protein SP-40, Complement cytolysis inhibitor, Apolipoprotein J, Testosterone-repressed prostate message 2, Aging-associated gene 4 protein, CLU and APOJ, is a secreted protein which belongs to the clusterin family. Clusterin/Apolipoprotein J/Apo-J is an enigmatic glycoprotein with a nearly ubiquitous tissue distribution and an apparent involvement in biological processes ranging from mammary gland involution to neurodegeneration in Alzheimer's disease. Its major form, a heterodimer, is secreted and present in physiological fluids, but truncated forms targeted to the nucleus have also been identified. Clusterin/Apolipoprotein J/Apo-J is a widely distributed glycoprotein with a wide range of biologic properties. A prominent and defining feature of clusterin is its marked induction in such disease states as glomerulonephritis, cystic renal disease, renal tubular injury, neurodegenerative conditions, atherosclerosis, and myocardial infarction. Upregulation of clusterin mRNA and protein levels detected in diverse disease states and in in vitro systems have led to suggestions that it functions in membrane lipid recycling, in apoptotic cell death, and as a stress-induced secreted chaperone protein, amongst others.

  • Silkensen JR, et al. (1994) The role of clusterin in tissue injury. Biochem Cell Biol. 72(11-12): 483-8.
  • Naik RR, et al. (2002) Biomimetic synthesis and patterning of silver nanoparticles. Nat Mater. 1(3): 169-72.
  • Djeu JY, et al. (2009) Clusterin and chemoresistance. Adv Cancer Res. 105: 77-92.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items