Quick Order

Text Size:AAA

Mouse FETUB ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FETUB cDNA Clone Product Information
Gene_bank_ref_id:NM_001083904.1
RefSeq ORF Size:1167bp
cDNA Description:Full length Clone DNA of Mus musculus fetuin beta with N terminal Flag tag.
Gene Synonym:Gugu, D17980, AI255764
Species:Mouse
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Fetuin-B, also known as Fetuin-like protein IRL685 and FETUB, is a secreted protein which belongs to the fetuin family. Fetuin-B / FETUB contains two cystatin domains. Fetuin-B is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption. Fetuin-A has been identified as a major protein during fetal life and is also involved in important functions such as protease inhibitory activities and development-associated regulation of calcium metabolism and osteogenesis. Fetuin-A is a key partner in the recovery phase of an acute inflammatory response. Fetuin-B / FETUB is found at least in human and rodents. It is unambiguously a paralogue of Fetuin-A. Fetuin-A and Fetuin-B exhibit significant differences at the amino acid sequence level, notably including variations with respect to the archetypal fetuin-specific signature.

References
  • Olivier E., et al., 2000, Biochem. J. 350:589-97
  • Liu T., et al., 2005, J. Proteome Res. 4:2070-80.
  • Hsu SJ, et al., 2005, Genome. 47 (5): 931-46.
  • Liu T, et al., 2006, J. Proteome Res.4 (6): 2070-80.
  • Size / Price
    Catalog: MG50572-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"