After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse KIT Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KITcDNA Clone Product Information
cDNA Size:2940
cDNA Description:ORF Clone of Mus musculus kit oncogene DNA.
Gene Synonym:W, Bs, Fdc, Ssm, SCO1, SCO5, SOW3, CD117, c-KIT, Tr-kit, Gsfsco1, Gsfsco5, Gsfsow3, Kit
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Receptor Tyrosine Kinase (RTK) Related Products
Product nameProduct name
Rat PDGFRa / CD140a Protein (Fc Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Cynomolgus EphB1 / EPHT2 Protein (His Tag)Cynomolgus FGFR1 / CD331 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Human KIT / c-KIT / CD117 Protein (Fc Tag)Human VEGFR1 / FLT-1 Protein (Fc Tag)Human FGFR2 / CD332 Protein (ECD, His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinCanine TrkB / NTRK2 Protein (Fc Tag)Rhesus HER3 / ErbB3 ProteinCynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human HER3 / ErbB3 ProteinHuman FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Mouse EphB6 Protein (His Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (Fc Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Human TrkB / NTRK2 Protein (His & Fc Tag)Human TrkB / NTRK2 Protein (His Tag)Human TrkC / NTRK3 Protein (His & Fc Tag)Human TrkC / NTRK3 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman IGF1R / CD221 Protein (His Tag)Human EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphB6 / EphB6 ProteinHuman HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human DDR2 Kinase / CD167b Protein (Fc Tag)Human DDR2 Kinase / CD167b Protein (His Tag)Human DDR2 Kinase / CD167b Protein (aa 422-855, His & GST Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB4 / HTK ProteinHuman Axl Kinase Protein (His Tag)Human MERTK / Mer Protein (His & Fc Tag)Human MERTK / Mer Protein GST TagHuman MERTK / Mer ProteinHuman MERTK / Mer(aa 578-872) ProteinHuman / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human Tie1 Protein (His Tag)Human PDGFRB / CD140b Protein (His & Fc Tag)Human CD140b / PDGFRB Protein (His Tag)Human PDGFRB / PDGFR-1 / CD140b ProteinHuman FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (Fc Tag)Human PDGFRa / CD140a Protein (Fc Tag)Human PDGFRa / CD140a Protein (His Tag)Human PDGFRa / CD140a Protein (His & GST Tag)Human PDGFRa / CD140a ProteinHuman FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human c-MET / HGFR Protein (His & Fc Tag)Human c-MET / HGFR Protein (His Tag)Human c-MET / HGFR Protein (aa 956-1390, His & GST Tag)Human Tie2 / CD202b Protein (His & Fc Tag)Human Tie2 / CD202b / TEK Protein (His Tag)Human Tie2 / CD202b / TEK Protein (His & GST Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (aa 444-913, His & GST Tag)Human EphB2 Protein (His & Fc Tag)Human EphB2 Protein (His Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB2 / Hek5 ProteinHuman VEGFR3 / FLT4 Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human FGFR2 Protein (His & Fc Tag)Human FGFR2 / CD332 Protein (His Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Cynomolgus / Rhesus c-MET / HGFR ProteinCynomolgus HER2 / ErbB2 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human TrkA / NTRK1 Protein (His & Fc Tag)Human TrkA / NTRK1 Protein (aa 285-413, His Tag)Human TrkA / NTRK1 Protein (aa 194-413, His Tag)Human TrkA / NTRK1 Protein (His Tag)Human Insulin Receptor / INSR / CD220 Protein (long isoform, His Tag)Human Insulin Receptor / INSR / CD220 Protein (His & GST Tag)Human Insulin Receptor / INSR / CD220 Protein (short isoform, His Tag)Human EphA4 Protein (His & Fc Tag)Human EphA4 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Human CD136 / MST1R Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Mouse Tie2 / CD202b / TEK Protein (ECD, Fc Tag)Human MUSK Kinase Protein (aa 433-783, His & GST Tag)Human EphB1 / EPHT2 Protein (His Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human KIT / c-KIT / CD117 Protein (aa 50-190, His Tag)Human c-KIT / CD117 Protein (His Tag)Human KIT / c-KIT / CD117 Protein (aa 540-972, His & GST Tag)Human RET Kinase Protein (His Tag)Human RET Kinase Protein (aa 658-1114, His & GST Tag)Cynomolgus FGFR3 Protein (Fc Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (His Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His Tag)Mouse Axl Kinase Protein (His & Fc Tag)Mouse Axl Kinase Protein (His Tag)Mouse TrkB / NTRK2 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Mouse TrkC / NTRK3 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse MERTK / Mer Protein (Fc Tag)Mouse MERTK / Mer Protein (His & GST Tag)Mouse c-kit / CD117 Protein (Fc Tag)Mouse c-kit / CD117 Protein (His Tag)Mouse DDR2 Kinase / CD167b Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse c-MET / HGFR Protein (Fc Tag)Mouse c-MET / HGFR Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse FGFR2 / CD332 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His & GST Tag)Canine HER2 / ErbB2 Protein (His Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Mouse HER4 / ErbB4 Protein (His Tag)Mouse Tie2 / TEK Protein (His Tag)Mouse Tie2 / TEK Protein (aa 770-1122, His & GST Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Mouse TrkA / NTRK1 Protein (Fc Tag)Mouse TrkA / NTRK1 Protein (His Tag)Canine c-MET / HGFR Protein (His Tag)Canine TrkB / NTRK2 Protein (His Tag)Canine TrkA / NTRK1 Protein (Fc Tag)Canine TrkA / NTRK1 Protein (His Tag)Rat c-MET / HGFR Protein (Fc Tag)Rat Tie2 / TEK Protein (Fc Tag)Rat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rat HER2 / ErbB2 ProteinRat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Rat EphA7 / EHK3 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Rat EphA4 Protein (Fc Tag) Rat EphA4 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rat TrkB / NTRK2 Protein (Fc Tag)Rat TrkB / NTRK2 Protein (His Tag)Rat KIT / c-KIT Protein (Fc Tag)Rat KIT / c-KIT Protein (His Tag)Rat DDR2 Kinase / CD167b Protein (Fc Tag)Rat DDR2 Kinase / CD167b Protein (His Tag)Rat PDGFRB / PDGFR-1 Protein (Fc Tag)Rat PDGFRB / PDGFR-1 Protein (His Tag)Rat TrkA / NTRK1 Protein (Fc Tag)Rat TrkA / NTRK1 Protein (His Tag)Rat DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag) Rat DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Cynomolgus EphA4 Protein (Fc Tag)Cynomolgus EphA4 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Cynomolgus FGFR1 / CD331 Protein (Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Cynomolgus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (His Tag)Cynomolgus PDGFRB / PDGFR-1 Protein (His Tag)Cynomolgus DDR2 Kinase / CD167b Protein (Fc Tag)Cynomolgus DDR2 Kinase / CD167b Protein (His Tag)Cynomolgus Tie2 / TEK Protein (Fc Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse EphB2 / Hek5 Protein (His Tag)Cynomolgus / Rhesus PDGFRB / CD140b Protein (Fc Tag)Rat HER4 / ErbB4 Protein (His Tag)Rat PDGFRa / CD140a Protein (His Tag)Cynomolgus EphB1 / EPHT2 Protein (Fc Tag)

C-Kit is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). c-Kit contains 5 Ig-like C2-type (immunoglobulin-like) domains.and 1 protein kinase domain. It belongs to the protein kinase superfamily, tyr protein kinase family and CSF-1/PDGF receptor subfamily. C-Kit contains 5 Ig-like C2-type (immunoglobulin-like) domains and 1 protein kinase domain. C-Kit has a tyrosine-protein kinase activity. Binding of the ligands leads to the autophosphorylation of KIT and its association with substrates such as phosphatidylinositol 3-kinase. Antibodies to c-Kit are widely used in immunohistochemistry to help distinguish particular types of tumour in histological tissue sections. It is used primarily in the diagnosis of GISTs. In GISTs, c-Kit staining is typically cytoplasmic, with stronger accentuation along the cell membranes. C-Kit antibodies can also be used in the diagnosis of mast cell tumours and in distinguishing seminomas from embryonal carcinomas. Mutations in c-Kit gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Defects in KIT are a cause of acute myelogenous leukemia (AML). AML is a malignant disease in which hematopoietic precursors are arrested in an early stage of development. Note=Somatic mutations that lead to constitutive activation of KIT are detected in AML patients.

  • Andre C, et al. (1997) Sequence analysis of two genomic regions containing the KIT and the FMS receptor tyrosine kinase genes. Genomics. 39(2):216-26.
  • Yarden Y, et al. (1987) Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO J. 6(11):3341-51.
  • Leong KG, et al. (2008) Generation of a prostate from a single adult stem cell. Nature. 456(7223): 804-8.
  • Edling CE, et al. (2007) c-Kit--a hematopoietic cell essential receptor tyrosine kinase. Int J Biochem Cell Biol. 39(11):1995-8.
  • McIntyre A, et al. (2005) Amplification and overexpression of the KIT gene is associated with progression in the seminoma subtype of testicular germ cell tumors of adolescents and adults. Cancer Res. 65(18):8085-9.