Quick Order

Text Size:AAA

Human CYGB Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CYGBcDNA Clone Product Information
cDNA Size:573
cDNA Description:ORF Clone of Homo sapiens cytoglobin DNA.
Gene Synonym:HGB, STAP, CYGB
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Cytoglobin, also known as CYGB, is a globin molecule ubiquitously expressed in all tissues and most notably utilized in marine mammals. Its avtual function is still unknown. It is thought to be a method of protection under conditions of hypoxia. The predicted function of cytoglobin is the transfer of oxygen from arterial blood to the brain. Cytoglobin is also present in chondroblasts and osteoblasts and shows a decreased level of expression upon differentiation to chondrocytes and osteocytes. Cytoglobin may facilitate diffusion of oxygen through tissues, scavenge nitric oxide or reactive oxygen species, or serve a protective function during oxidative stress.

  • Burmester T. et al., 2002, Mol Biol Evol. 19 (4): 416-21.
  • Trent JT. et al., 2002, J Biol Chem. 277 (22): 19538-45.
  • Kawada N. et al., 2001, J Biol Chem. 276 (27): 25318-23.
  • Schmidt M. et al., 2004, J Biol Chem. 279 (9): 8063-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items