After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GIF Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GIFcDNA Clone Product Information
cDNA Size:1254
cDNA Description:ORF Clone of Homo sapiens gastric intrinsic factor (vitamin B synthesis) DNA.
Gene Synonym:IF, INF, IFMH, TCN3, GIF
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Gastric intrinsic factor, also known as GIF, belongs to the of the cobalamin transport protein family. It is a glycoprotein produced by the parietal cells of the stomach. Gastric intrinsic factor plays a key role in the absorption of vitamin B12 on in the small intestine. Vitamin B12 bounds to haptocorrin after entry into the stomach. The resulting complex enters the duodenum, where pancreatic enzymes digest haptocorrin. In the less acidic environment of the small intestine, B12 can then bind to gastric intrinsic factor. This new complex travels to the ileum, where special epithelial cells endocytose them. Inside the cell, B12 dissociates once again and binds to another protein, transcobalamin II. The new complex can exit the epithelial cells to enter the liver.

  • Gerdin AK. (2010) The Sanger Mouse Genetics Programme: high throughput characterisation of knockout mice. Acta Opthalmologica. 88:925-7.
  • AU - Berlin H, et al. (1968) ORAL TREATMENT OF PERNICIOUS ANEMIA WITH HIGH DOSES OF VITAMIN B12 WITHOUT INTRINSIC FACTOR. Acta Medica Scandinavica. 184(1-6):247-58.
  • Hewitt JE, et al. (1991) Human gastric intrinsic factor: characterization of cDNA and genomic clones and localization to human chromosome 11. Genomics. 10(2):432-40.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items