After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse Neuropilin-1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NRP1cDNA Clone Product Information
cDNA Size:2772
cDNA Description:ORF Clone of Mus musculus Neuropilin 1 DNA.
Gene Synonym:Nrp, NP-1, Npn1, NPN-1, C530029I03, Nrp1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Vascular Endothelial Growth Factor (VEGF) & Receptor Related Products
Product nameProduct name
Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 ProteinHuman VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGF121 / VEGF-A ProteinHuman Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human Neuropilin 2 / NRP2 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGF-B / VEGFB Protein (Fc Tag)Human VEGF121 / VEGF-A ProteinHuman VEGF121b / VEGF-A ProteinMouse PIGF / PLGF Protein (Fc Tag)Mouse PIGF / PLGF ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Mouse VEGF-D / VEGFD / FIGF Protein (His Tag)Mouse VEGFA / VEGF164 ProteinMouse VEGFR3 / FLT-4 Protein (Fc Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Danio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinCanine VEGF / VEGFA ProteinRat VEGF164 / VEGFA ProteinRat VEGFR1 / FLT-1 Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)

Neuropilin is a type I transmembrane protein and the molecular mass is 120 kDa. Two homologues, Neuropilin-1 and Neuropilin-2, are identified. The primary structure of Neuropilin-1 and Neuropilin-2 is well conserved and is divided into four domains, CUB (a1/a2) domain, FV/FVIII (b1/b2) domain, MAM (c) domain, and (d) domain that contains a transmembrane and a short cytoplasmic region. Neuropilin-1 (NRP1) acts as a receptor for two different extracellular ligands, class 3 semaphorins and specific isoforms of vascular endothelial growth factor. The functions of NRP1 and NRP2 have been extensively studied in neurons where they act in axon guidance and in endothelial cells where they promote angiogenesis and cell migration. Neuropilin-1 is likely to mediate contacts between the dendritic cells and the T lymphocytes via homotypic interactions and is essential for the initiation of the primary immune response. NRP1 is a co-receptor for VEGF receptor-2 (VEGFR2) that enhances the binding of VEGF165 to VEGFR2 and VEGF165-mediated chemotaxis. NRP1 expression is regulated in EC by tumor necrosis factor-alpha, the transcription factors dHAND and Ets-1, and vascular injury. NRP1 upregulation is positively correlated with the progression of various tumors. Overexpression of NRPI in rat tumor cells results in enlarged tumors and substantially enhanced tumor angiogenesis. On the other hand, soluble NRP1 (sNRP1) is an antagonist of tumor angiogenesis.

  • Nakamura F, et al. (2002) Structural and functional relation of neuropilins. Adv Exp Med Biol. 515: 55-69.
  • Romeo PH, et al. (2002) Neuropilin-1 in the immune system. Adv Exp Med Biol. 515: 49-54.
  • Klagsbrun M, et al. (2002) The role of neuropilin in vascular and tumor biology. Adv Exp Med Biol. 515: 33-48.
  • Staton CA, et al. (2007) Neuropilins in physiological and pathological angiogenesis. J Pathol. 212(3): 237-48.
  • Bagri A, et al. (2009) Neuropilins in tumor biology. Clin Cancer Res. 15(6): 1860-4.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items