Quick Order

Text Size:AAA

Human ART3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ART3cDNA Clone Product Information
Gene_bank_ref_id:BC008397
cDNA Size:1170
cDNA Description:ORF Clone of Homo sapiens ADP-ribosyltransferase 3 DNA.
Gene Synonym:ART3
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

ART3 is an arginine-specific ADP-ribosyltransferase which belongs to the Arg-specific ADP-ribosyltransferase family. ART3 catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. It is expressed specifically in testis. ART3 pseudogene is located on chromosome 11. ART3 was identified as a susceptibility gene for non-obstructive azoospermia (NOA). It is a novel therapeutic target in the treatment of NOA.

References
  • Lévy I, et al. (1996) Human testis specifically expresses a homologue of the rodent T lymphocytes RT6 mRNA. FEBS Lett. 382(3):276-80.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200 (1-2):149-56.
  • Balducci E, et al. (1999) Selective expression of RT6 superfamily in human bronchial epithelial cells. Am J Respir. 21(3):337-46.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"