Quick Order

Mouse CADM4 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CADM4 cDNA Clone Product Information
Gene_bank_ref_id:NM_153112.3
RefSeq ORF Size:1167bp
cDNA Description:Full length Clone DNA of Mus musculus cell adhesion molecule 4 with C terminal Flag tag.
Gene Synonym:Tsll2, Igdf4c, Igsf4c, Cadm4
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Immunoglobulin superfamily member 4C (IGSF4C), also known as CADM4 or NECL-4, is an immunoglobulin (Ig) superfamily molecule showing significant homology with a lung tumor suppressor, TSLC1. CADM4/IGSF4C/NECL-4 protein is mainly expressed in the kidney, bladder, and prostate in addition to the brain. Experiments have reported the biological significance of CADM4/IGSF4C/NECL-4 in the urinary tissues. An immunohistochemical study reveals that CADM4 is expressed at the cell-cell attachment sites in the renal tubules, the transitional epithelia of the bladder, and the glandular epithelia of the prostate. IGSF4-immunoreactivity (IR) was observed diffusely in the telencephalic wall, whereas it became rather confined to the subplate, the cortical plate and the subventricular zone as the development proceeded. IGSF4-IR gradually decreased after birth and disappeared in adulthood. IGSF4 remained at low levels throughout embryonic stage, whereas it increased after birth. These spatiotemporal patterns of the expression suggest that IGSF4 plays crucial roles in the development of both telencephalon and cerebellum. CADM4/IGSF4C/NECL-4 is ectopically expressed in adult T-cell leukemia (ATL) cells, providing not only a diagnostic marker for ATL, but also a possible therapeutic target against its invasion. The distinct roles of CADM4/IGSF4C/NECL-4 in the oncogenesis of carcinomas and ATL could be due to tissue-specific differences in the downstream cascades, and is a novel concept with respect to cell adhesion in human oncogenesis.

References
  • Williams YN, et al. (2006) Cell adhesion and prostate tumor-suppressor activity of TSLL2/IGSF4C, an immunoglobulin superfamily molecule homologous to TSLC1/IGSF4. Oncogene. 25(10): 1446-53.
  • Ohta Y, et al. (2005) Spatiotemporal patterns of expression of IGSF4 in developing mouse nervous system. Brain Res Dev Brain Res. 156(1): 23-31.
  • Shingai T, et al. (2003) Implications of nectin-like molecule-2 /IGSF4 /RA175 /SgIGSF /TSLC1 /SynCAM1 in cell-cell adhesion and transmembrane protein localization in epithelial cells. J Biol Chem. 278(37): 35421-7.
  • Size / Price
    Catalog: MG50501-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"