Quick Order

Human IZUMO1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IZUMO1cDNA Clone Product Information
cDNA Size:1053
cDNA Description:ORF Clone of Homo sapiens izumo sperm-egg fusion 1 DNA.
Gene Synonym:IZUMO, IZUMO1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Izumo is a sperm membrane protein which plays a key role in the fusion in the mouse. It has an Immunoglobulin (Ig) domain and an N-terminal domain for which neither the functions nor homologous sequences are known. Up to now, there four members has an N-terminal domain with significant homology to the N-terminal domain of Izumo. We call this domain Izumo domain. The four proteins are Izumo 1, 2, 3, and 4. Izumo domain possesses the ability to form dimers, whereas the transmembrane domain or the cytoplasmic domain or both of Izumo 1 are required for the formation of multimers of higher order. Izumo 1-3 are transmembrane proteins expressed specifically in the testis, and Izumo 4 is a soluble protein expressed in the testis and in other tissues. Izumo 1, 3, and 4 formed protein complexes on sperm, Izumo 1 forming several larger complexes and Izumo 3 and 4 forming a single larger complex. Izumo1 is essential for sperm-egg plasma membrane binding and fusion.

  • Inoue N, et al. (2008) Putative sperm fusion protein IZUMO and the role of N-glycosylation. Biochem Biophys Res Commun. 377(3):910-4.
  • Ikram MK, et al. (2010) Four novel Loci (19q13, 6q24, 12q24, and 5q14) influence the microcirculation in vivo. PLoS Genet. 6(10):e1001184.
  • Sklar P, et al. (2011) Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 43(10):977-83.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items