Quick Order

Text Size:AAA

Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PPM1GcDNA Clone Product Information
Gene_bank_ref_id:NM_177983.1
cDNA Size:1641
cDNA Description:ORF Clone of Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent, 1G DNA.
Gene Synonym:PP2CG, PPP2CG, MGC1675, MGC2870, PP2CGAMMA, PPM1G
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11245-ACG$345
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11245-ACR$345
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11245-ANG$345
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11245-ANR$345
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11245-CF$315
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11245-CH$315
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11245-CM$315
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11245-CY$315
Human PPM1G Gene cDNA Clone (full-length ORF Clone)HG11245-M$115
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11245-M-F$315
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11245-M-N$315
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11245-NF$315
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11245-NH$315
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11245-NM$315
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11245-NY$315
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11245-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Protein phosphatase 1G, also known as Protein phosphatase 1C, Protein phosphatase 2C isoform gamma, Protein phosphatase magnesium-dependent 1 gamma, PP2C-gamma, PPM1G and PPM1C, is a cytoplasm protein which belongs to the PP2C family. PPM1G / PP2C-gamma is widely expressed. It is most abundant in testis, skeletal muscle, and heart. Alternatively spliced transcript variants encoding the same protein have been described. PP2C family members are known to be negative regulators of cell stress response pathways.  PPM1G / PP2C-gamma is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. PPM1G / PP2C-gamma also plays a role in regulating cell cycle progression.

References
  • Travis S.M., et al., 1997, FEBS Lett. 412:415-9.
  • Molina H., et al., 2007, Proc. Natl. Acad. Sci. USA. 104: 2199-204.
  • Matsuoka S., et al., 2007, Science 316:1160-6.
  • Size / Price
    Catalog:HG11245-NY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"