After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat PRLR Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRLRcDNA Clone Product Information
cDNA Size:1833
cDNA Description:ORF Clone of Rattus norvegicus prolactin receptor DNA.
Gene Synonym:RATPRLR, MGC105486, Prlr
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Prolactin receptor (PRLR) is a single-pass transmembrane receptor belonging to the type â…  cytokine receptor superfamily, and contains two fibronectin type-â…¢ domains. All class 1 ligands activate their respective receptors by clustering mechanisms. Ligand binding results in the transmembrane PRLR dimerization, followed by phosphorylation and activation of the molecules invloved in the signaling pathways, such as Jak-STAT, Ras/Raf/MAPK. The PRLR contains no intrinsic tyrosine kinase cytoplasmic domain but associates with a cytoplasmic tyrosine kinase, JAK2. PRLR mainly serves as the receptor for the pituitary hormone prolactin (PRL), a secreted hormone that affects reproduction and homeostasis in vertebrates. PRLR can be regulated by an interplay of two different mechanisms, PRL or ovarian steroid hormones independently or in combination in a tissue-specific manner. The role of the hormone prolactin (PRL) in the pathogenesis of breast cancer is mediated by its cognate receptor (PRLR). Ubiquitin-dependent degradation of the PRLR that negatively regulates PRL signaling is triggered by PRL-mediated phosphorylation of PRLR on Ser349 followed by the recruitment of the beta-transducin repeats-containing protein (beta-TrCP) ubiquitin-protein isopeptide ligase. which altered PRLR stability may directly influence the pathogenesis of breast cancer.

  • Bole-Feysot C, et al. (1998) Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr Rev. 19(3): 225-68.
  • Goffin V, et al. (1999) From the molecular biology of prolactin and its receptor to the lessons learned from knockout mice models. Genet Anal. 15(3-5): 189-201.
  • Li Y, et al. (2006) Stabilization of prolactin receptor in breast cancer cells. Oncogene. 25(13): 1896-902.
  • Shao R, et al. (2008) Differences in prolactin receptor (PRLR) in mouse and human fallopian tubes: evidence for multiple regulatory mechanisms controlling PRLR isoform expression in mice. Biol Reprod. 79(4): 748-57.