After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat LCN2 / NGAL Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LCN2cDNA Clone Product Information
cDNA Size:597
cDNA Description:ORF Clone of Rattus norvegicus lipocalin 2 DNA.
Gene Synonym:LCN2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Lipocalin-2 (LCN2), also known as neutrophil gelatinase-associated lipocalin (NGAL), is a 25 kDa protein belonging to the lipocalin superfamily. It was initially found in activated neutrophils, however, many other cells, like kidney tubular cells, may produce NGAL in response to various insults. This protein is released from injured tubular cells after various damaging stimuli, is already known by nephrologists as one of the most promising biomarkers of incoming Acute Kidney Injury (AKI). Recent evidence also suggests its role as a biomarker in a variety of other renal and non-renal conditions. Moreover, recent studies seem to suggest a potential involvement of this factor also in the genesis and progression of chronic kidney diseases. NGAL is the first known mammalian protein which specifically binds organic molecules called siderophores, which are high-affinity iron chelators. NGAL, first known as an antibacterial factor of natural immunity, and an acute phase protein, is currently one of the most interesting and enigmatic proteins involved in the process of tumor development. acting as an intracellular iron carrier and protecting MMP9 from proteolytic degradation, NGAL has a clear pro-tumoral effect, as has already been observed in different tumors (e.g. breast, stomach, oesophagus, brain) in humans. In thyroid carcinomas, NGAL is strongly induced by NF-kB, an important factor involved both in tumor growth and in the link between chronic inflammation and neoplastic development. Thus, Lipocalin-2 (LCN2/NGAL) has been implicated in a variety of processes including cell differentiation, proliferation, survival and morphogenesis.

  • Schmidt-Ott KM, et al. (2006) Neutrophil gelatinase-associated lipocalin-mediated iron traffic in kidney epithelia. Curr Opin Nephrol Hypertens. 15(4): 442-9.
  • Bolignano D, et al. (2010) Neutrophil gelatinase-associated lipocalin (NGAL) in human neoplasias: a new protein enters the scene. Cancer Lett. 288(1): 10-6.
  • Soni SS, et al. (2010) NGAL: a biomarker of acute kidney injury and other systemic conditions. Int Urol Nephrol. 42(1): 141-50.
  • Bolignano D, et al. (2010) From kidney to cardiovascular diseases: NGAL as a biomarker beyond the confines of nephrology. Eur J Clin Invest. 40(3): 273-6.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks