After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human OSMR / IL-31RB ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human OSMR cDNA Clone Product Information
Gene_bank_ref_id:NM_003999.1
RefSeq ORF Size:2940bp
cDNA Description:Full length Clone DNA of Homo sapiens oncostatin M receptor1 with N terminal HA tag.
Gene Synonym:OSMRB, MGC75127, MGC150626, MGC150627,
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Human Interleukin-31 receptor A / IL31RA Protein (Fc Tag, ECD)Canine IL-6R / CD126 Protein (ECD, His Tag)Human Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA Protein (Fc Tag)Human G-CSF / CSF3 Protein (isoform b)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Rat IL-11RA1 / Il11RA1 Protein (His Tag)Mouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human IL6 / Interleukin-6 ProteinHuman IL6R / CD126 Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin ProteinHuman LIFR / CD118 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6RA / CD126 Protein (His Tag)Mouse IL11RA / IL11Rα Protein (His Tag)Human OSMR / IL31RB Protein (His Tag)Human CNTFR / CNTFR-alpha Protein (His Tag)Human IL11RA / IL11Rα Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Human CNTF Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat CNTFR / CNTFR-alpha Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Rat CNTF / Ciliary Neurotrophic Factor ProteinHuman G-CSFR / CD114 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)Human Oncostatin M / OSM Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Rat IL-6R / CD126 Protein (ECD, His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse Oncostatin M / OSM Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinRat IL6 / Interleukin-6 ProteinRat LIFR Protein (His Tag)Rhesus IL6 / Interleukin-6 ProteinHuman IL11 / Interleukin 11 / IL-11 ProteinHuman LIF Protein (His Tag)Human LIF Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rhesus IL6ST / gp130 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rhesus IL6ST / gp130 Protein (His Tag)Human IL6ST / gp130 / CD130 ProteinHuman GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinCanine IL11RA / IL-11RA / IL11Rα ProteinRat GM-CSF / CSF2 Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Human LIF ProteinHuman IL-31 / IL31 Protein (His Tag)Mouse GM-CSF / CSF2 ProteinMouse IL-11 / interleukin 11 ProteinSus scrofa (pig) IL6 / IL-6 ProteinRat IL-6R / CD126 Protein (Fc Tag, ECD)Mouse LIF ProteinHuman Interleukin-31 receptor A / IL31RA Protein (His Tag)
Background

Oncostatin-M specific receptor subunit beta also known as the oncostatin M receptor (OSMR) and Interleukin-31 receptor subunit beta (IL-31RB), is one of the receptor proteins for oncostatin M. OSMR is a member of the type I cytokine receptor family. IL-31RB/OSMR heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in IL-31RB/OSMR have been associated with familial primary localized cutaneous amyloidosis. Defects in IL-31RB/OSMR are the cause of amyloidosis primary localized cutaneous type 1 (PLCA1), also known as familial lichen amyloidosis or familial cutaneous lichen amyloidosis. PLCA1 is a hereditary primary amyloidosis characterized by localized cutaneous amyloid deposition. This condition usually presents with itching (especially on the lower legs) and visible changes of skin hyperpigmentation and thickening (lichenification) that may be exacerbated by chronic scratching and rubbing. The amyloid deposits probably reflect a combination of degenerate keratin filaments, serum amyloid P component, and deposition of immunoglobulins.

References
  • Arita K, et al.. (2008) Oncostatin M Receptor-β Mutations Underlie Familial Primary Localized Cutaneous Amyloidosis. Am J Hum. Genet. 82 (1): 73-80.
  • Malaval L, et al.. (2005) GP130/OSMR is the only LIF/IL-6 family receptor complex to promote osteoblast differentiation of calvaria progenitors. J Cell Physiol. 204(2): 585-93.
  • Lin MW, et al.. (2010) Novel IL31RA gene mutation and ancestral OSMR mutant allele in familial primary cutaneous amyloidosis. Eur J Hum Genet. 18(1): 26-32.
  • Size / Price
    Catalog: HG11226-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"