Quick Order

Text Size:AAA

Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTPN11cDNA Clone Product Information
cDNA Size:1782
cDNA Description:ORF Clone of Mus musculus protein tyrosine phosphatase, non-receptor type 11, transcript variant 2 DNA.
Gene Synonym:Syp, Shp2, PTP1D, PTP2C, SAP-2, SHP-2, SH-PTP2, SH-PTP3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50462-ACG$345
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50462-ACR$345
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50462-ANG$345
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50462-ANR$345
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50462-CF$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50462-CH$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50462-CM$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50462-CY$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)MG50462-M$115
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50462-NF$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50462-NH$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50462-NM$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50462-NY$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50462-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

SHP2, also known as PTPN11, belongs to the protein-tyrosine phosphatase(PTP) family, non-receptor class 2 subfamily. PTPs catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They dephosphorylate EGFR, JAK2 and TYK2 kinases, promoting oncogenic transformation. SHP2 is widely expressed, with highest levels in heart, brain, and skeletal muscle. SHP2 acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. It also dephosphorylates ROCK2 at Tyr-722 resulting in stimulatation of its RhoA binding activity.

  • Ganju R K, et al. (2000) Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem. 275(23):17263-8.
  • Yin T, et al. (1997) Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases. J Biol Chem. 272(2):1032-7.
  • Kontaridis MI, et al. (2006) PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281(10):6785-92.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items