After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse SPARC Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SPARCcDNA Clone Product Information
cDNA Size:909
cDNA Description:ORF Clone of Mus musculus secreted acidic cysteine rich glycoprotein DNA.
Gene Synonym:BM-40, AA517111
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Secreted protein acidic and rich in cysteine (SPARC), also known as Osteonectin (ON), is a member of the SPARC family. SPARC consists of three domains: a EF-hand domain, a follistatin-like domain and a Kazal-like domain, and each of which has independent activity and unique properties. The activity of SPARC is context- and cell-type-dependent, which is highlighted by the fact that SPARC has shown seemingly contradictory effects on tumor progression in both clinical correlative studies and in animal models. The location of SPARC in the nuclear matrix of certain proliferating cells, but only in the cytosol of postmitotic neurons, indicates potential functions of SPARC as a nuclear protein, which might be involved in the regulation of cell cycle progression and mitosis. It functions not only to modulate cell-cell and cell-matrix interactions, but its de-adhesive and growth inhibitory properties in non-transformed cells have led to studies to assess its role in cancer. Its divergent actions reflect the complexity of this protein, because in certain types of cancers, such as melanomas and gliomas, SPARC is associated with a highly aggressive tumor phenotype, while in others, mainly ovarian, neuroblastomas and colorectal cancers, SPARC may function as a tumor suppressor. Recent studies have also demonstrated a role for SPARC in sensitizing therapy-resistant cancers. Notably, SPARC is linked to human obesity.

  • Yan Q, et al. (1999) SPARC, a matricellular glycoprotein with important biological functions. J Histochem Cytochem. 47(12): 1495-506.
  • Brekken RA, et al. (2000) SPARC, a matricellular protein: at the crossroads of cell-matrix. Matrix Biol. 19(7): 569-80.
  • Tai IT, et al. (2008) SPARC in cancer biology: its role in cancer progression and potential for therapy. Drug Resist Updat. 11(6): 231-46.
  • Podhajcer OL, et al. (2008) The role of the matricellular protein SPARC in the dynamic interaction between the tumor and the host. Cancer Metastasis Rev. 27(3): 523-37.
  • Kos K, et al. (2010) SPARC: a key player in the pathologies associated with obesity and diabetes. Nat Rev Endocrinol. 6(4): 225-35.