After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SMNDC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SMNDC1cDNA Clone Product Information
cDNA Size:717
cDNA Description:ORF Clone of Homo sapiens survival motor neuron domain containing 1 DNA.
Gene Synonym:SMNR, SPF30, SMNDC1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

SMNDC1 gene is a paralog of SMN1 gene, which encodes the survival motor neuron protein, mutations in which are cause of autosomal recessive proximal spinal muscular atrophy. SMNDC1 is a nuclear protein that has been identified as a constituent of the spliceosome complex. SMNDC1 gene is differentially expressed, with abundant levels in skeletal muscle, and may share similar cellular function as the SMN1 gene. SMNDC1 is necessary for spliceosome assembly. Its overexpression causes apoptosis.

  • Rappsilber J, et al. (2001) SPF30 is an essential human splicing factor required for assembly of the U4/U5/U6 tri-small nuclear ribonucleoprotein into the spliceosome. J Biol Chem. 276(33): 31142-50.
  • Talbot K, et al. (1999) Characterization of a gene encoding survival motor neuron (SMN)-related protein, a constituent of the spliceosome complex. Hum Mol Genet. 7(13): 2149-56.
  • Neubauer G, et al. (1998) Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat Genet. 20(1):46-50.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items