After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human ABL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ABL1cDNA Clone Product Information
cDNA Size:3450
cDNA Description:ORF Clone of Homo sapiens c-abl oncogene 1, receptor tyrosine kinase DNA.
Gene Synonym:ABL, JTK7, p150, c-ABL, v-abl, bcr/abl,
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

c-Abl belongs to the class of tyrosine kinases and is the prototype of a subfamily which includes two members, c-Abl and Arg (Abl-related gene). Both proteins are localized at the cell membrane, actin cytoskeleton and cytosol, and c-Abl is present in the nucleus as well. c-Abl is a non-receptor tyrosine kinase that participates in multiple signaling pathways linking the cell surface, cytoskeleton, and the nucleus. Recent in vitro studies have also linked c-Abl to amyloid-beta-induced toxicity and tau phosphorylation. c-Abl has been implicated in many cellular processes including differentiation, division, adhesion, death, and stress response. c-Abl is a latent tyrosine kinase that becomes activated in response to numerous extra- and intra-cellular stimuli. The c-Abl protein is a ubiquitously expressed nonreceptor tyrosine kinase involved in the development and function of many mammalian organ systems, including the immune system and bone. It regulates the cellular response to TAM through functional interaction with the estrogen receptor, which suggests c-Abl as a therapeutic target and a prognostic tumor marker for breast cancer. c-Abl also plays a key role in signaling chemokine-induced T-cell migration. In addition, c-Abl contains NLSs (nuclear localization signals) and DNA-binding sequences important for nuclear functions. c-Abl has become an important therapeutic target in human chronic myeloid leukaemia.

  • Qiu Z, et al. (2010) c-Abl tyrosine kinase regulates cardiac growth and development. Proc Natl Acad Sci U S A. 107(3): 1136-41.
  • Huang Y, et al. (2008) The c-Abl tyrosine kinase regulates actin remodeling at the immune synapse. Blood. 112(1): 111-9.
  • Sirvent A, et al. (2008) Cytoplasmic signalling by the c-Abl tyrosine kinase in normal and cancer cells. Biol Cell. 100(11): 617-31.
  • Shaul Y, et al. (2005) Role of c-Abl in the DNA damage stress response. Cell Res. 15(1): 33-5.