Quick Order

Human NAA10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NAA10cDNA Clone Product Information
Gene_bank_ref_id:BC000308
cDNA Size:708
cDNA Description:ORF Clone of Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit DNA.
Gene Synonym:TE2, ARD1, NATD, ARD1A, DXS707
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

ARD1 is a member of the 20-kDa ARF protein family. It is a multifunctional protein. ARD1 has an 18-kDa ADP-ribosylation factor (ARF) domain at the C-terminus (amino acids 403-574), and a 46-kDa N-terminal domain (amino acids 1-402). The C-terminal region of ARD1 may be involved in the formation of both ARD1-ARD1 and ARD1-NAT1 complexes. ARD1 and NAT1 genes are required for the expression of an N-terminal protein acetyltransferase. This activity is required for full repression of the silent mating type locus HML, for sporulation, and for entry into G0. Recombinant ARD1 (amino acids 1-574) or its RING finger domain (amino acids 1-110) produced polyubiquitylated proteins when incubated in vitro with a mammalian E1, an E2 enzyme, ATP, and ubiquitin.

Size / Price
Catalog:HG14293-NH
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"