Quick Order

Human RYBP Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RYBPcDNA Clone Product Information
cDNA Size:687
cDNA Description:ORF Clone of Homo sapiens RING1 and YY1 binding protein DNA.
Gene Synonym:AAP1, DEDAF, YEAF1, RYBP
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

APAP-1, also known as AAP1 and RYBP, is widely expressed. It is highest expressed in lymphoid tissues and placenta. APAP-1 contains 1 RanBP2-type zinc finger. It may bind to DNA. APAP-1 inhibits ubiquitination and subsequent degradation of TP53, and thereby plays a role in regulating transcription of TP53 target genes. It may be implicated in the regulation of the transcription as a repressor of the transcriptional activity of E4TF1. APAP-1 also promotes apoptosis.

  • Li Mao, et al. (2009) RYBP stabilizes p53 by modulating MDM2. EMBO Rep. 10(2):166-72.
  • Schlisio, et al. (2002) Interaction of YY1 with E2Fs, mediated by RYBP, provides a mechanism for specificity of E2F function. EMBO J. 21(21):5775-86.
  • Peter M E, et al. (2001) The death effector domain-associated factor plays distinct regulatory roles in the nucleus and cytoplasm. J Biol Chem. 276(34):31945-52.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items