Quick Order

Text Size:AAA

Rat MET Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
METcDNA Clone Product Information
cDNA Size:4149
cDNA Description:ORF Clone of Rattus norvegicus met proto-oncogene (hepatocyte growth factor receptor) DNA.
Gene Synonym:HGFR, AUTS9, RCCP2, c-Met, MET
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Receptor Tyrosine Kinase (RTK) Related Products
Product nameProduct name
Rat PDGFRa / CD140a Protein (Fc Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Cynomolgus EphB1 / EPHT2 Protein (His Tag)Cynomolgus FGFR1 / CD331 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Human KIT / c-KIT / CD117 Protein (Fc Tag)Human VEGFR1 / FLT-1 Protein (Fc Tag)Human FGFR2 / CD332 Protein (ECD, His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinCanine TrkB / NTRK2 Protein (Fc Tag)Rhesus HER3 / ErbB3 ProteinCynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human HER3 / ErbB3 ProteinHuman FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Mouse EphB6 Protein (His Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (Fc Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Human TrkB / NTRK2 Protein (His & Fc Tag)Human TrkB / NTRK2 Protein (His Tag)Human TrkC / NTRK3 Protein (His & Fc Tag)Human TrkC / NTRK3 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman IGF1R / CD221 Protein (His Tag)Human EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphB6 / EphB6 ProteinHuman HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human DDR2 Kinase / CD167b Protein (Fc Tag)Human DDR2 Kinase / CD167b Protein (His Tag)Human DDR2 Kinase / CD167b Protein (aa 422-855, His & GST Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB4 / HTK ProteinHuman Axl Kinase Protein (His Tag)Human MERTK / Mer Protein (His & Fc Tag)Human MERTK / Mer Protein GST TagHuman MERTK / Mer ProteinHuman MERTK / Mer(aa 578-872) ProteinHuman / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human Tie1 Protein (His Tag)Human PDGFRB / CD140b Protein (His & Fc Tag)Human CD140b / PDGFRB Protein (His Tag)Human PDGFRB / PDGFR-1 / CD140b ProteinHuman FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (Fc Tag)Human PDGFRa / CD140a Protein (Fc Tag)Human PDGFRa / CD140a Protein (His Tag)Human PDGFRa / CD140a Protein (His & GST Tag)Human PDGFRa / CD140a ProteinHuman FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human c-MET / HGFR Protein (His & Fc Tag)Human c-MET / HGFR Protein (His Tag)Human c-MET / HGFR Protein (aa 956-1390, His & GST Tag)Human Tie2 / CD202b Protein (His & Fc Tag)Human Tie2 / CD202b / TEK Protein (His Tag)Human Tie2 / CD202b / TEK Protein (His & GST Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (aa 444-913, His & GST Tag)Human EphB2 Protein (His & Fc Tag)Human EphB2 Protein (His Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB2 / Hek5 ProteinHuman VEGFR3 / FLT4 Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human FGFR2 Protein (His & Fc Tag)Human FGFR2 / CD332 Protein (His Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Cynomolgus / Rhesus c-MET / HGFR ProteinCynomolgus HER2 / ErbB2 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human TrkA / NTRK1 Protein (His & Fc Tag)Human TrkA / NTRK1 Protein (aa 285-413, His Tag)Human TrkA / NTRK1 Protein (aa 194-413, His Tag)Human TrkA / NTRK1 Protein (His Tag)Human Insulin Receptor / INSR / CD220 Protein (long isoform, His Tag)Human Insulin Receptor / INSR / CD220 Protein (His & GST Tag)Human Insulin Receptor / INSR / CD220 Protein (short isoform, His Tag)Human EphA4 Protein (His & Fc Tag)Human EphA4 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Human CD136 / MST1R Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Mouse Tie2 / CD202b / TEK Protein (ECD, Fc Tag)Human MUSK Kinase Protein (aa 433-783, His & GST Tag)Human EphB1 / EPHT2 Protein (His Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human KIT / c-KIT / CD117 Protein (aa 50-190, His Tag)Human c-KIT / CD117 Protein (His Tag)Human KIT / c-KIT / CD117 Protein (aa 540-972, His & GST Tag)Human RET Kinase Protein (His Tag)Human RET Kinase Protein (aa 658-1114, His & GST Tag)Cynomolgus FGFR3 Protein (Fc Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (His Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His Tag)Mouse Axl Kinase Protein (His & Fc Tag)Mouse Axl Kinase Protein (His Tag)Mouse TrkB / NTRK2 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Mouse TrkC / NTRK3 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse MERTK / Mer Protein (Fc Tag)Mouse MERTK / Mer Protein (His & GST Tag)Mouse c-kit / CD117 Protein (Fc Tag)Mouse c-kit / CD117 Protein (His Tag)Mouse DDR2 Kinase / CD167b Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse c-MET / HGFR Protein (Fc Tag)Mouse c-MET / HGFR Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse FGFR2 / CD332 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His & GST Tag)Canine HER2 / ErbB2 Protein (His Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Mouse HER4 / ErbB4 Protein (His Tag)Mouse Tie2 / TEK Protein (His Tag)Mouse Tie2 / TEK Protein (aa 770-1122, His & GST Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Mouse TrkA / NTRK1 Protein (Fc Tag)Mouse TrkA / NTRK1 Protein (His Tag)Canine c-MET / HGFR Protein (His Tag)Canine TrkB / NTRK2 Protein (His Tag)Canine TrkA / NTRK1 Protein (Fc Tag)Canine TrkA / NTRK1 Protein (His Tag)Rat c-MET / HGFR Protein (Fc Tag)Rat Tie2 / TEK Protein (Fc Tag)Rat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rat HER2 / ErbB2 ProteinRat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Rat EphA7 / EHK3 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Rat EphA4 Protein (Fc Tag) Rat EphA4 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rat TrkB / NTRK2 Protein (Fc Tag)Rat TrkB / NTRK2 Protein (His Tag)Rat KIT / c-KIT Protein (Fc Tag)Rat KIT / c-KIT Protein (His Tag)Rat DDR2 Kinase / CD167b Protein (Fc Tag)Rat DDR2 Kinase / CD167b Protein (His Tag)Rat PDGFRB / PDGFR-1 Protein (Fc Tag)Rat PDGFRB / PDGFR-1 Protein (His Tag)Rat TrkA / NTRK1 Protein (Fc Tag)Rat TrkA / NTRK1 Protein (His Tag)Rat DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag) Rat DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Cynomolgus EphA4 Protein (Fc Tag)Cynomolgus EphA4 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Cynomolgus FGFR1 / CD331 Protein (Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Cynomolgus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (His Tag)Cynomolgus PDGFRB / PDGFR-1 Protein (His Tag)Cynomolgus DDR2 Kinase / CD167b Protein (Fc Tag)Cynomolgus DDR2 Kinase / CD167b Protein (His Tag)Cynomolgus Tie2 / TEK Protein (Fc Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse EphB2 / Hek5 Protein (His Tag)Cynomolgus / Rhesus PDGFRB / CD140b Protein (Fc Tag)Rat HER4 / ErbB4 Protein (His Tag)Rat PDGFRa / CD140a Protein (His Tag)Cynomolgus EphB1 / EPHT2 Protein (Fc Tag)

Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET), is a receptor tyrosine kinase (RTK) that has been shown to be overexpressed and/or mutated in a variety of malignancies. HGFR protein is produced as a single-chain precursor, and HGF is the only known ligand. Normal HGF/HGFR signaling is essential for embryonic development, tissue repair or wound healing, whereas aberrantly active HGFR has been strongly implicated in tumorigenesis, particularly in the development of invasive and metastatic phenotypes. HGFR protein is a multifaceted regulator of growth, motility, and invasion, and is normally expressed by cells of epithelial origin. Preclinical studies suggest that targeting aberrant HGFR signaling could be an attractive therapy in cancer.

  • McGill GG, et al. (2006) c-Met expression is regulated by Mitf in the melanocyte lineage. J Biol Chem. 281(15): 10365-73.
  • Garcia S, et al. (2007) c-Met overexpression in inflammatory breast carcinomas: automated quantification on tissue microarrays. British journal of cancer. 96(2): 329-35.
  • Socoteanu MP, et al. (2008) c-Met targeted therapy of cholangiocarcinoma. World J Gastroenterol. 14(19): 2990-4.
  • Kong DS, et al. (2009) Prognostic significance of c-Met expression in glioblastomas. Cancer. 115(1): 140-8.
  • Size / Price
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items