Quick Order

Mouse MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAP3K8cDNA Clone Product Information
Gene_bank_ref_id:NM_007746.2
cDNA Size:1404
cDNA Description:ORF Clone of Mus musculus mitogen-activated protein kinase kinase kinase 8 DNA.
Gene Synonym:Cot, Est, Estf, Tpl2, Tpl-2, c-COT, Cot/Tpl2, Map3k8
Species:Mouse
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Mitogen-activated protein kinase kinase kinase 8, also known as Cancer Osaka thyroid oncogene, Proto-oncogene c-Cot, Serine/threonine-protein kinase cot, Tumor progression locus 2 and MAP3K8, is a cytoplasm protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase kinase subfamily. MAP3K8 is expressed in several normal tissues and human tumor-derived cell lines. Isoform 1 of MAP3K8 is activated specifically during the S and G2/M phases of the cell cycle. MAP3K8 is required for TLR4 activation of the MEK/ERK pathway. It is able to activate NF-kappa-B 1 by stimulating proteasome-mediated proteolysis of NF-kappa-B 1/p105. MAP3K8 plays a role in the cell cycle. The longer form has some transforming activity, although it is much weaker than the activated cot oncoprotein. MAP3K8 oncogene linked to human endometrial carcinoma suggesting that it may be another molecule involved in human endometrial cancer. MAP3K8 may also be an important mediator of intracellular mechanotransduction in human bone marrow-derived mesenchymal stem cells (MSCs).

References
  • Clark,A.M. et al., 2004, Genes Chromosomes Cancer. 41 (2):99-108.
  • Chan,H. et al., 2005, Biochem Biophys Res Commun. 328 (1):198-205.
  • Aparecida Alves,C. et al., 2006, Eur J Gynaecol Oncol. 27 (6):589-93.
  • Mielke,L.A. et al., 2009, J Immunol. 183 (12):7984-93.
  • Glossop,J.R. et al., 2009,Gene Expr Patterns  9 (5):381-8. 
  • Size / Price
    Catalog:MG50438-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"