After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRDX1cDNA Clone Product Information
Gene_bank_ref_id:BC007063.1
cDNA Size:600
cDNA Description:ORF Clone of Homo sapiens peroxiredoxin 1 DNA.
Gene Synonym:PAG, PAGA, PAGB, PRX1, PRXI, MSP23, NKEFA, TDPX2, PRDX1
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11194-ACG$325
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11194-ACR$325
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11194-ANG$325
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11194-ANR$325
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11194-CF$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11194-CH$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11194-CM$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11194-CY$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone)HG11194-M$195
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11194-M-F$395
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11194-M-N$395
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11194-NF$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11194-NH$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11194-NM$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11194-NY$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11194-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

References
  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Size / Price
    Catalog:HG11194-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"