After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LYG1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LYG1 cDNA Clone Product Information
Gene_bank_ref_id:BC029126
RefSeq ORF Size:585bp
cDNA Description:Full length Clone DNA of Homo sapiens lysozyme G-like 1 with C terminal HA tag.
Gene Synonym:SALW1939, LYG1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Lysozyme G-like 1 belongs to the glycosyl hydrolase 23 family. Glycoside hydrolases are a widespread group of enzymes that hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. Lysozyme G-like 1 exhibits hydrolase activity, acting on glycosyl bonds (inferred); lysozyme activity (inferred). It is found in extracellular region and may functions in cell wall macromolecule catabolic process, metabolic process and peptidoglycan catabolic process. The lysozyme G gene structure has been largely conserved during vertebrate evolution, except at the 5' end of the gene, which varies in number of exons.

References
  • EIrwin DM, et al. (2003) Molecular evolution of vertebrate goose-type lysozyme genes. J Mol Evol. 56(2):234-42.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Sklar P, et al. (2011) Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 43(10):977-83.
  • Size / Price
    Catalog: HG13457-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"