Quick Order

Mouse S100A3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A3cDNA Clone Product Information
cDNA Size:306
cDNA Description:ORF Clone of Mus musculus S100 calcium binding protein A3 DNA.
Gene Synonym:S100E, S100a3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Protein S100-A3, also known as Protein S-100E, S100 calcium-binding protein A3, S100A3 and S100E, is a member of the S-100 family. S100A3 / S100E contains 2 EF-hand domains. S100A3 / S100E is highly expressed in the differentiating cuticular cells within the hair follicle and organized into mature hair cuticles. High concentrations of S100A3 homotetramer might provide the millimolar level of Ca2+ required for hair cuticular barrier formation. S100A3 / S100E is a unique member of the Ca2+-binding S100 protein family with the highest cysteine content and affinity for Zn2+. S100A3 / S100E binds both calcium and zinc. S100A3 / S100E probably binds 2 zinc ions per molecule. It may be involved in calcium-dependent cuticle cell differentiation and hair shaft formation. S100A3 plays an important role in calcium-dependent processes leading to hair shaft formation. S100A3 / S100E is a unique protein among all members of the calcium-binding S100 family, is specifically expressed at the inner endocuticle of human hair fibers. Upon hair damage, S100A3 / S100E is released from hair fibers and possibly destabilizes the hair tissue architecture.

  • Kizawa, K. et al., 2008, J Biol Chem. 283 (8):5004-13.
  • Kizawa, K. et al., 1998, J Invest Dermatol. 111 (5):879-86.
  • Kizawa, K. et al., 2002, Biochem Biophys Res Commun. 299 (5):857-62.
  • Fritz,G. et al., 2002, J Biol Chem. 277 (36):33092-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks