Quick Order

Human ADH7 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ADH7 cDNA Clone Product Information
Gene_bank_ref_id:BC131512
RefSeq ORF Size:1161bp
cDNA Description:Full length Clone DNA of Homo sapiens alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide with N terminal Myc tag.
Gene Synonym:ADH4
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Calcium/calmodulin-dependent protein kinase type I I subunit alpha, also known as CaM kinase II subunit alpha, CAMKA, and CAMK2A, is a member of the protein kinase superfamily, CAMK Ser/Thr protein kinase family, and CaMK subfamily. CAMK2A contains one protein kinase domain. CAMK2 is a prominent kinase in the central nervous system that may function in long-term potentiation and neurotransmitter release. As a member of the NMDAR signaling complex in excitatory synapses, it may regulate NMDAR-dependent potentiation of the AMPAR and synaptic plasticity. CAMK2 is composed of four different chains: alpha, beta, gamma, and delta. The different isoforms assemble into homo- or heteromultimeric holoenzymes composed of 8 to 12 subunits. CAMK2 interacts with BAALC, MPDZ, SYN1, CAMK2N2 and SYNGAP1.

References
  • Nagase T., et al., 1999, DNA Res. 6: 63-70.
  • Schmutz J., et al., 2004, Nature. 431: 268-274.
  • Krapivinsky G., et al., 2004, Neuron 43:563-574. 
  • Ignotz,GG. et al., 2005, Biol Reprod. 73 (3): 519-26.
  • Size / Price
    Catalog: HG15947-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"