After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PROCR Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PROCRcDNA Clone Product Information
cDNA Size:717
cDNA Description:ORF Clone of Homo sapiens protein C receptor, endothelial (EPCR) DNA.
Gene Synonym:CCCA, EPCR, CCD41, CD201, bA42O4.2, PROCR
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Endothelial protein C receptor (EPCR), also known as activated protein C receptor (APC receptor) or PROCR, is a receptor for Protein C. Protein C plays an important role in many metabolism processes in humans and other animals after activated by binding to Endothelial protein C receptor (EPCR). Because of the EPCR is found primarily on endothelial cells (cells on the inside of blood vessels), activated protein C is found maily near endothelial cells. Protein C is pleiotropic, with two main functions: anticoagulation and cytoprotection. Which function will be performed depend on whether or not protein C remains bind to EPCR after activated. The anticoagulation occurs when it does not. In this case, protein C functions as an anticoagulant by irreversibly proteolytically inactivating Factor Va and Factor VIIIa, turning them into Factor Vi and Factor VIIIi respectively. When still bound to EPCR, activated protein C performs its cytoprotective effects, acting on the effector substrate PAR-1, protease-activated receptor-1. To a degree, APC's anticoagulant properties are independent of its cytoprotective ones, in that expression of one pathway is not affected by the existence of the other. 

  • Nicolaes GA, et al. (2003). Congenital and acquired activated protein C resistance. Semin Vasc Med. 3 (1): 33-46.
  • Esmon CT. ( 2003). The protein C pathway. Chest 124 (3): 26-32.
  • Mosnier LO, et al. (2007)The cytoprotective protein C pathway. Blood. 109: 3161-72.