Quick Order

Text Size:AAA

Human PAF / KIAA0101 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KIAA0101 cDNA Clone Product Information
Gene_bank_ref_id:NM_014736.4
RefSeq ORF Size:336bp
cDNA Description:Full length Clone DNA of Homo sapiens platelet-activating factor with N terminal HA tag.
Gene Synonym:L5, PAF, OEATC1, NS5ATP9, OEATC-1, p15(PAF), KIAA0101
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

KIAA0101, also known as p15(PAF), is a proliferating cell nuclear antigen-associated factor which interacts with proliferating cell nuclear antigen(PCNA). It was initially isolated in a yeast two-hybrid screen for PCNA binding partners, and was shown to bind PCNA competitively with the cell cycle regulator p21(WAF). KIAA0101 is localized primarily in the nucleus. It shares the conserved PCNA binding motif with several other PCNA binding proteins including CDK inhibitor p21 . KIAA0101 is involved in cell proliferation and plays a role in early tumor recurrence (ETR), and prognosis of hepatocellular carcinoma (HCC). KIAA0101 is expressed predominantly in liver, pancreas and placenta. It cannot be detected in heart or brain. It is highly expressed in a number of tumors, especially esophageal tumors, in anaplastic thyroid carcinomas and in non-small-cell lung cancer lines. Overexpression of KIAA0101 predicts high stage, early tumor recurrence, and poor prognosis of hepatocellular carcinoma. It also may be involved in protection of cells from UV-induced cell death.

References
  • Yu P, et al. (2001) p15(PAF), a novel PCNA associated factor with increased expression in tumor tissues. Oncogene. 20 (4): 484-9.
  • Simpson F, et al. (2005) The PCNA-associated factor KIAA0101/p15(PAF) binds the potential tumor suppressor product p33ING1b. Exp Cell Res. 312 (1): 73-85.
  • Guo M, et al. (2006) KIAA0101 (OEACT-1), an expressionally down-regulated and growth-inhibitory gene in human hepatocellular carcinoma. BMC Cancer. 6: 109.
  • Nagase T, et al. (1995) Prediction of the coding sequences of unidentified human genes. III. The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res. 2 (1): 37-43.
  • Size / Price
    Catalog: HG10997-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"