Quick Order

Mouse CRIP2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CRIP2cDNA Clone Product Information
Gene_bank_ref_id:NM_024223.2
cDNA Size:627
cDNA Description:ORF Clone of Mus musculus cysteine rich protein 2 DNA.
Gene Synonym:Crp, Hlp, CRP2, CRP4, ESP1, C77570, AW743261, 0610010I23Rik
Species:Mouse
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

CRIP2 is a putative transcription factor. It has a widespread tissue expression and is highly expressed in heart. CRIP2 contains two LIM zinc-binding domains. CRIP2 may participate in the differentiation of smooth muscle tissue. It also plays an important role in esophageal squamous cell carcinoma (ESCC) tumorigenesis. CRIP2 acts as a transcription repressor of the NF-κB-mediated proangiogenic cytokine expression and thus functionally inhibits tumor formation and angiogenesis. It interacts with the NF-κB/p65 to inhibit its DNA-binding ability to the promoter regions of the major proangiogenesis cytokines critical for tumor progression, including IL6, IL8, and VEGF. In conclusion, we provide compelling evidence that CRIP2 acts as a transcription repressor of the NF-κB-mediated proangiogenic cytokine expression and thus functionally inhibits tumor formation and angiogenesis.

References
  • Chang DF. et al., 2003, Dev Cell. 4 (1):107-18.
  • Huber A. et al., 2000, J Biol Chem. 275 (8): 5504-11.
  • Karim MA. et al., 1996, Genomics. 31 (2): 167-76.
  • Size / Price
    Catalog:MG52478-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"