After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CLEC1B ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CLEC1B cDNA Clone Product Information
Gene_bank_ref_id:NM_016509.3
RefSeq ORF Size:690bp
cDNA Description:Full length Clone DNA of Homo sapiens C-type lectin domain family 1, member B with N terminal HA tag.
Gene Synonym:CLEC2, CLEC2B, PRO1384, QDED721, 1810061I13Rik
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CLEC1B, also known as CLEC2, is a C-type lectin-like receptor expressed in myeloid cells and NK cells. Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 and NKG2D, that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 acts as a receptor for the platelet-aggregating snake venom protein rhodocytin. Rhodocytin binding leads to tyrosine phosphorylation and this promotes the binding of spleen tyrosine kinase (Syk) and initiation of downstream tyrosine phosphorylation events and activation of PLC-gamma-2. CLEC2 contains 1 C-type lectin domain and is expressed preferentially in the liver. It acts as an attachment factor for human immunodeficiency virus type 1 (HIV-1) and facilitates its capture by platelets.

References
  • Suzuki-Inoue K, et al. (2007) Involvement of the snake toxin receptor CLEC-2, in podoplanin-mediated platelet activation, by cancer cells. J Biol Chem. 282(36):25993-6001.
  • Watson AA, et al. (2007) The crystal structure and mutational binding analysis of the extracellular domain of the platelet-activating receptor CLEC-2. J Biol Chem. 282(5):3165-72.
  • Chaipan C, et al. (2006) DC-SIGN and CLEC-2 mediate human immunodeficiency virus type 1 capture by platelets. J Virol. 80(18):8951-60.
  • Size / Price
    Catalog: HG10976-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"