After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse F11 / FXI Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
F11cDNA Clone Product Information
cDNA Size:1875
cDNA Description:ORF Clone of Mus musculus coagulation factor XI DNA.
Gene Synonym:FXI, Cf11, AI503996, 1600027G01Rik, F11
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Factor XI (plasma thromboplastin antecedent) is a plasma glycoprotein, and a zymogen acting as a serine protease which participates in blood coagulation as a catalyst in the conversion of factor IX to factor IXa in the presence of calcium ions. It is an unusual dimeric protease, with structural features that distinguish it from vitamin K-dependent coagulation proteases. The factor XI is synthesized in the liver as a single polypeptide chain with a molecular weight estimated between 125 ~160 kDa and then is processed into a disulfide-bond linked homodimer. FXI is a homodimer, with each subunit containing four apple domains and a protease domain. The apple domains form a disk structure with binding sites for platelets, high molecular weight kininogen, and the substrate factor IX (FIX). FXI is converted to the active protease FXIa by cleavage of the Arg369-Ile370 bond on each subunit. After the activation reaction, Factor XIa is composed of two heavy and two light chains held together by three disulfide bonds. The heavy chains are derived from the amino termini of the zymogen and responsible for the binding of factor XI to high molecular weight kininogen and for the activation of factor IX, while the light chain contains the catalytic portion of the enzyme and is homologous to the trypsin family of serine proteases. FXI deficiency is a disorder characterized by a mild or no bleeding tendency. Severe FXI deficiency is an injury-related bleeding disorder common in Ashkenazi Jews and rare worldwide.

  • Gailani D, et al. (2009) Structural and functional features of factor XI. J Thromb Haemost. 7 Suppl 1: 75-8.
  • Duga S, et al. (2009) Factor XI Deficiency. Semin Thromb Hemost. 35(4): 416-25.
  • Emsley J, et al. (2010) Structure and function of factor XI. Blood. 115(13): 2569-77.