Quick Order

Text Size:AAA

Human AMY2A ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AMY2A cDNA Clone Product Information
Gene_bank_ref_id:BC007060
RefSeq ORF Size:1536bp
cDNA Description:Full length Clone DNA of Homo sapiens amylase, alpha 2A (pancreatic) with C terminal HA tag.
Gene Synonym:PA, AMY2, AMY2B, AMY2A
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Alpha-amylase is the major form of amylase found in humans and other mammals. Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. Alpha-amylase hydrolyses alpha bonds of large, alpha-linked polysaccharides, such as starch and glycogen, yielding glucose and maltose. Amylases is widely expressed and is most prominent in pancreatic juice and saliva, each of which has its own isoform of human α-amylase. They behave differently on isoelectric focusing, and can also be separated in testing by using specific monoclonal antibodies.

References
  • Abe A, et al. (2005) Complexes of Thermoactinomyces vulgaris R-47 Alpha-amylase / AMY2A 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with alpha-(1,6) glycosidic linkages. FEBS J. 272(23):6145-53.
  • Aghajari, N, et al. (1998) Crystal structures of the psychrophilic Alpha-amylase / AMY2A from Alteromonas haloplanctis in its native form and complexed with an inhibitor. Protein Sci. 7(3): 564-72.
  • Ramasubbu, N, et al. (1996) Structure of Human Salivary -Amylase at 1.6 Resolution: Implications for its Role in the Oral Cavity. Acta Crystallographica Section D Biological Crystallography. 52(3):435-46.
  • Size / Price
    Catalog: HG13277-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"