Quick Order

Mouse PPM1A ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PPM1A cDNA Clone Product Information
Gene_bank_ref_id:NM_008910.2
RefSeq ORF Size:1149bp
cDNA Description:Full length Clone DNA of Mus musculus protein phosphatase 1A, magnesium dependent, alpha isoform with N terminal Flag tag.
Gene Synonym:MMPa-2, MPPa-1, AI427932, AU017636, 2310003C21Rik, 2900017D14Rik, Ppm1a
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Protein phosphatase 1A (PPM1A / PP2CA) is an enzyme belonging to the PP2C family of Ser / Thr protein phosphatases. Members of PP2C family are negative regulators of cell stress response pathways and the MAP kinases and MAP kinase kinases. It has also been demonstrated to inhibit the activation of p38 and JNK kinase cascades. PPM1A dephosphorylates and promotes nuclear export of TGFβ-activated Smad2/3. Ectopic expression of PPM1A abolishes TGFβ-induced antiproliferative and transcriptional responses, whereas depletion of PPM1A enhances TGFβ signaling in mammalian cells. It has been demonstrated that PPM1A / PP2CA, through dephosphorylation of Smad2/3, plays a critical role in terminating TGFβ signaling. Overexpression of PPM1A is reported to activate the expression of the tumor suppressor gene TP53 / p53, which leads to cell apoptosis.

References
  • Lin X, et al. (2006) PPM1A functions as a Smad phosphatase to terminate TGFbeta signaling. Cell. 125(5): 915-28.
  • Marc F, et al. (2003) Protein phosphatase 2C binds selectively to and dephosphorylates metabotropic glutamate receptor 3. Proc Natl Acad. 100 (26): 16006-11.
  • Mann DJ, et al. (1992) Mammalian protein serine/threonine phosphatase 2C: cDNA cloning and comparative analysis of amino acid sequences. Biochim Biophys Acta. 1130 (1): 100-4.
  • Size / Price
    Catalog: MG50277-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"