Quick Order

Text Size:AAA

Human ACO1 / IREB1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACO1 cDNA Clone Product Information
NCBI RefSeq:NM_002197.2
RefSeq ORF Size:2670bp
cDNA Description:Full length Clone DNA of Homo sapiens aconitase 1, soluble with N terminal HA tag.
Gene Synonym:IRP1, ACONS, IREB1, IREBP, IREBP1,
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Aconitase 1(ACO1) or IRP1 is one member of the aconitase family that contains a diverse group of iron-sulphur(Fe-S) isomerases and two types of iron regulatory protein. Aconitase exits in two forms: one is soluble and the other is mitochondrial. ACO1 is the soluble existing form, and the mitochondrial form is ACO2. Residues from all three N-terminal domains and the larger C-terminal domain contribute to the active site region. When the enzyme is activated, it gains an additional iron atom. ACO1 can assume two different functions in cells, depending on different conditions. During iron scarcity or oxidative stress, ACO1 binds to mRNA stem-loop structures called iron responsive elements to modulate the translation of iron metabolism genes. In iron-rich conditions, ACO1 binds an iron-sulfur cluster to function as a cytosolic aconitase. 

References
  • Robbins AH, et al. (1989) The structure of aconitase. Proteins: Structure, Function, and Bioinformatics. 5 (4): 289-312.
  • Volz K. (2008) The functional duality of iron regulatory protein 1. Curr Opin Struct Biol. 18 (1): 106-11.
  • Gruer MJ, et al. (1997) The aconitase family: three structural variations on a common theme. Trends Biochem Sci. 22 (1): 3-6.
  • Size / Price
    Catalog: HG10966-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"