After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse ACP5 / TRAP Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACP5cDNA Clone Product Information
cDNA Size:984
cDNA Description:ORF Clone of Mus musculus acid phosphatase 5, tartrate resistant DNA.
Gene Synonym:TRAP, TRACP, Acp5
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Tartrate-resistant acid phosphatase (TRACP) or acid phosphatase 5, tartrate resistant (ACP5 or TRAP) is a glycosylated monomeric metalloenzyme expressed in mammals. TRACP is associated with osteoblast migration to bone resorption sites, and, once there, TRACP is believed to initiate osteoblast differentiation, activation, and proliferation. TRACP once considered to be just a histochemical marker of osteoclasts is now recognised to be a molecule of widespread occurrence with functions in both the skeleton and the immune system. Two forms of TRACP circulate in human blood, TRACP 5a derived from macrophages and dendritic cells, and TRACP-5b derived from osteoclasts. Recent data have demonstrated the utility of TRACP-5b as a marker of osteoclast number and bone resorption, and serum TRACP-5a as a marker of inflammatory conditions. TRACP is expressed by osteoclasts, macrophages, dendritic cells and a number of other cell types. It has a critical role in many biological processes including skeletal development, collagen synthesis and degradation, the mineralisation of bone, cytokine production by macrophages and dendritic cells, macrophage recruitment, dendritic cell maturation and a role in the development of Th1 responses.

  • Hayman AR. (2008) Tartrate-resistant acid phosphatase (TRAP) and the osteoclast/immune cell dichotomy. Autoimmunity. 41(3): 218-23.
  • Halleen JM, et al. (2006) Tartrate-resistant acid phosphatase 5b (TRACP 5b) as a marker of bone resorption. Clin Lab. 52(9-10): 499-509.
  • Mochizuki Y. (2006) Bone and bone related biochemical examinations. Bone and collagen related metabolites. Tartrate-resistant acid phosphatase (TRACP). Clin Calcium. 16(6): 948-55.
  • Lamp EC, et al. (2000) Biology of tartrate-resistant acid phosphatase. Leuk Lymphoma. 39(5-6): 477-84.