After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse HDAC8 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse HDAC8 cDNA Clone Product Information
Gene_bank_ref_id:NM_027382.3
RefSeq ORF Size:1134bp
cDNA Description:Full length Clone DNA of Mus musculus histone deacetylase 8 with N terminal Flag tag.
Gene Synonym:2610007D20Rik
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Histone deacetylase 8, also known as HDAC8 and HDACL1, is a nucleus and cytoplasm protein which belongs to the histone deacetylase family and HD type 1 subfamily. Histone deacetylases (HDACs) are a growing family of enzymes implicated in transcriptional regulation by affecting the acetylation state of core histones in the nucleus of cells. HDAC8 / HDACL1 is weakly expressed in most tissues. It expressed at higher level in heart, brain, kidney and pancreas and also in liver, lung, placenta, prostate and kidney. HDAC8 / HDACL1 is responsible for the deacetylation of lysine residues on the N-terminal part of the core histones ( H2A, H2B, H3 and H4 ). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. HDAC8 / HDACL1 may play a role in smooth muscle cell contractility. HDAC8 / HDACL1 may be a potential drug target for neuroblastoma differentiation therapy using selective inhibitors, avoiding unspecific side effects.

References
  • Buggy JJ. et al.,2000, Biochem J. 350 (1): 199-205.
  • Krennhrubec K. et al., 2007, Bioorg Med Chem Lett. 17 (10): 2874-8.
  • Oehme I. et al., 2009, Expert Opin Investig Drugs.18 (11): 1605-17.
  • Size / Price
    Catalog: MG50273-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"