Quick Order

Mouse PIK3IP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PIK3IP1cDNA Clone Product Information
cDNA Size:795
cDNA Description:ORF Clone of Mus musculus phosphoinositide-3-kinase interacting protein 1 DNA.
Gene Synonym:Crkd, Hgfl, RP23-191E3.6, 1500004A08Rik, 5830455E04Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

PIK3IP1 contains 1 kringle domain and is a negative regulator of phosphatidylinositol-3-kinase (PI3K), suppresses the development of hepatocellular carcinoma. PI3K is a well-known regulator of cell division, motility, metabolism and survival in most cell types. Proper liver function and development highly depend on intact PI3K signal transduction. Aberrant PI3K pathway signaling in the liver is associated with hepatocellular carcinoma. PI3K signaling is involved in the homeostasis of lipid and glucose metabolism. Activation of the PI3K pathway induces lipogenesis and glycogenesis in the liver, since both Akt overexpressing transgenic mice and PTEN knockout mice develop fatty liver and hypoglycemia. PIK3IP1 overexpression can contribute to glucose homeostasis and fatty deposition.

  • He X, et al. (2008) PIK3IP1, a negative regulator of PI3K, suppresses the development of hepatocellular carcinoma. Cancer Res. 68(14):5591-8.
  • Gao P, et al. (2008) Both PIK3IP1 and its novel found splicing isoform, PIK3IP1-v1, are located on cell membrane and induce cell apoptosis. Beijing Da Xue Xue Bao. 40(6):572-7.
  • Zhu Z, et al. (2007) PI3K is negatively regulated by PIK3IP1, a novel p110 interacting protein. Biochem Biophys Res Commun. 358(1):66-72.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items