Quick Order

Text Size:AAA

Mouse LTA4H ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse LTA4H cDNA Clone Product Information
Gene_bank_ref_id:NM_008517.2
RefSeq ORF Size:1836bp
cDNA Description:Full length Clone DNA of Mus musculus leukotriene A4 hydrolase with N terminal Flag tag.
Gene Synonym:Lta4h
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Mouse leukotriene A-4 hydrolase, also known as LTA-4 hydrolase, Leukotriene A (4) hydrolase, LTA4H and LTA4, is cytoplasm protein which belongs to the peptidase M1 family. LTA4H hydrolyzes an epoxide moiety of leukotriene A4 (LTA-4) to form leukotriene B4 (LTB-4). This enzyme also has some peptidase activity. The leukotrienes (LTs) are a class of structurally related lipid mediators involved in the development and maintenance of inflammatory and allergic reactions. In the biosynthesis of LTs, arachidonic acid was converted into the unstable intermediate epoxide LTA4, which may in turn be conjugated with glutathione to form the spasmogenic LTC4, or hydrolyzed into the proinflammatory lipid mediator LTB4 in a reaction catalyzed by Leukotriene A4 hydrolase (LTA4H). LTB4 is a classical chemoattractant of human neutrophils and triggers adherence and aggregation of leukocytes to vascular endothelium, and also modulates immune responses. As a bifunctional zinc metalloenzyme, LTA4H also exhibits an anion-dependant arginyl aminopeptidase activity of high efficiency and specificity in addition to its epoxide hydrolase activity. LTA4H is regarded as a therapeutic target for inflammation.

References
  • Mancini, JA. et al.,1995, Eur. J. Biochem. 231: 65-71.
  • Orning, L. et al., 1994, J. Biol. Chem. 269: 11269-73.
  • Rudberg, PC. et al., 2004, J. Biol. Chem. 279: 27376-82.
  • Qiu, H. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 8161-6.
  • Size / Price
    Catalog: MG50268-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"